DNA

TACACCCTGTGGGATCTTGGGAACGTCCATATC

04/17/14    Historical Influences on Darwin

1.     Out of the five individuals I believe that Thomas Malthus had the most influence over Darwin’s development of his theory of Natural Science.

2.     What Thomas Malthus contributed to the Scientific Community was to influence Darwin with his essay the Principle of Population (1798), which had his observation that in nature plants and animals produce for more offspring than can survive, and that man is capable of over producing if left unchecked. Malthus speculated the natural outcome of population growth would be famine and poverty.  http://www.allaboutscience.org/malthus-faq.htm

3.     Malthus thoughts on families’ sizes need to be regulated, because he speculated that the outcome of man would lead to famine and poverty. Darwin disproved this with his example of rabbits and their production rates. Rabbits have the potential to produce 200 offspring in their lifetime. Darwin showed that with natural selection, the rabbits were not able to produce their potential.

4.     Yes I believe that Darwin could of came up with his theory of natural selection without the help of Thomas Malthus. The reason I believe this is because natural selection deals with ideal traits being passed down to the off spring, which he observed on the Galapagos Islands.

 The Church took offence towards Darwin and prolonged the publication of his book. It took 23 years of work for Darwin to be able to release his book